Home FAQs The yield of my sgRNA is low – what can I do to improve the yield?

FAQ: The yield of my sgRNA is low – what can I do to improve the yield?

First, verify that the yield of RNA obtained when using the sgRNA control oligo, S. pyogenes is ≥ 15µg.  It is imperative that the reaction is set up at room temperature and that the components are added in the order listed in the manual, with the enzyme added last and to each reaction separately.  

If the control oligo gives the expected yield check the design of the target-specific oligo.  Make sure that at least one “G” is directly downstream of the T7 promoter sequence (TTCTAATACGACTCACTATAG) for efficient transcription.  Also, verify that the sequence of the 14 nucleotide overlap region (3’ end of the target-specific oligo) is correct
(5’ GTTTTAGAGCTAGA 3’).

It is important to note that a wide range of yields were obtained when testing a large panel of target-specific oligos, and therefore yield is at least partially dependent on the exact sequence of the oligos. If higher yield is required, a longer incubation at 37°C is reasonable (1-2 hours).